View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11566_high_12 (Length: 308)
Name: NF11566_high_12
Description: NF11566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11566_high_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 44606769 - 44606508
Alignment:
| Q |
1 |
acaatgtggatggaggcaatgatggcagcgaagaacatgtatcctcgattaccaaccactacagagatcacatcttcttcagtttcggttgtgatttcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44606769 |
acaatgtggatggaggcaatgatggcagcgaagaacatgtatcctcgattaccaaccactgcagagatcacatctccttcagtttcggttgtgatttcca |
44606670 |
T |
|
| Q |
101 |
cagacaagttgaggcaacgacttttgcaagagggtgtaaatgagattgctattcgtgaatgtgaagacattatgagagctgagttattccagttgcacac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44606669 |
cagacaagttgaggcaacgacttttgcaagagggtgtaaatgagattgctattcgtgaatgtgaagacattatgagagctgagttattccagttgcacac |
44606570 |
T |
|
| Q |
201 |
ttatattgttgccctaaagcagaaacaattgttactcactgacacactccgtaatttagagg |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44606569 |
ttatattgttgccctaaagcagaaacaattgttactcactgacacactccgtaatttagagg |
44606508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University