View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11566_high_14 (Length: 276)
Name: NF11566_high_14
Description: NF11566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11566_high_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 12 - 259
Target Start/End: Original strand, 14330370 - 14330620
Alignment:
| Q |
12 |
agagattaaatatacatagaagattgtcagtgatatatagagaaggnnnnnnnn---ctaaggtttaaggagggtatgtttttcgatgggatcaattgaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
14330370 |
agagattaaatatacatagaagattgtcagtgatatatagagaaggaaaaaaaaaaactaaggtttaaggagggtatgtttttcgatgggatcgattgaa |
14330469 |
T |
|
| Q |
109 |
cttttaggacggtttcattacaaccttgaataacctctgtggtcatcatattgttccatgaaatcatcattgaactttttgaaactatccataatagcag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14330470 |
cttttaggacggtttcattacaaccttgaataacctctgtggtcatcatattgttccatgaaatcatcattgaactttttgaaactatccataatagcag |
14330569 |
T |
|
| Q |
209 |
gcatttcttcctcagctggtaatatagttgtcctcaaatggaacaccctat |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14330570 |
gcatttcttcctcagctggtaatatagttgtcctcaaatggaacaccctat |
14330620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University