View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11566_high_8 (Length: 343)
Name: NF11566_high_8
Description: NF11566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11566_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 1 - 150
Target Start/End: Complemental strand, 48448592 - 48448443
Alignment:
| Q |
1 |
accggacacactgacaggacacgtcagcacggatcaaattttgaaaaaatgaattaattgaatgcaatgaaatgtatcagtgacgacacccgacgcagct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| |
|
|
| T |
48448592 |
accggacacactgacaggacacgtcagcacggatcaaattttgaaaaaatgaattaattgaatgcaatgaaatgtgtcagtgacgacacccgacgcggct |
48448493 |
T |
 |
| Q |
101 |
tccattagaagtgtcatagtgactcatgttttctcaattcgaaaccagat |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48448492 |
tccattagaagtgtcatagtgactcatgttttctcaattcgaaaccagat |
48448443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 243 - 328
Target Start/End: Complemental strand, 48448335 - 48448250
Alignment:
| Q |
243 |
gttactcaatcatatccaatgatttatttgtgtatgcttcaaagaggttatctatccgttcaaattgctttgtagttgttctcttc |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48448335 |
gttactcaatcatatccaatgatttatttgtgtatgcttcaaagaggttatctatccgttcaaattgctttgtagttgttctcttc |
48448250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University