View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11566_low_18 (Length: 248)

Name: NF11566_low_18
Description: NF11566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11566_low_18
NF11566_low_18
[»] chr6 (1 HSPs)
chr6 (72-161)||(1807253-1807342)


Alignment Details
Target: chr6 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 72 - 161
Target Start/End: Original strand, 1807253 - 1807342
Alignment:
72 tacactcaaccatccactcattattattctaataatctccatttctcaaaactttctccaacaaccttacctcacctcatcacaccacta 161  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1807253 tacactcaaccatccactcattattattctaataatctccatttctcaaaactttctccaacaaccttacctcacctcatcacaccacta 1807342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University