View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11567_high_12 (Length: 318)
Name: NF11567_high_12
Description: NF11567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11567_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 8e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 17 - 313
Target Start/End: Original strand, 53740351 - 53740639
Alignment:
| Q |
17 |
catcaactatgttgttaacggcagaccatgatgatcgagttgcgccactacactcattgaagctattggcgg-tagtgggctatacaagcattatagatt |
115 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |||| ||| |
|
|
| T |
53740351 |
catcaactatgttgttaacggcagatcatgatgatcgagttgtgccactacactcattgaagctattggcggttagtgggctatacaagca-tataaatt |
53740449 |
T |
 |
| Q |
116 |
ttttcatcgaaaacacaacttatatttattgaaatatgttgcaagtaacagaataagtggttataaaactaaagaaattaacaaatagttgtcacata-n |
214 |
Q |
| |
|
||||||| | ||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
53740450 |
ttttcattg-aaacacaacttatatttattgaattatgttgcaagtaacagaataagtggttat-aaactaaagaaattaacaaatagttgtcacatagg |
53740547 |
T |
 |
| Q |
215 |
nnnnnnataggtcatcattctcgtgtgaccagaccactgtgggaggaaaatcccattccagtcatcacaatttaccacccttttccttttcttctctct |
313 |
Q |
| |
|
||||||| |||||||||||||| || ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53740548 |
ggggggataggtcgtcattctcgtgtgatca-------ctgggaggaaaatctcattccagtcatcacaatttaccacccttttccttttcttctctct |
53740639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 43 - 89
Target Start/End: Original strand, 8559468 - 8559514
Alignment:
| Q |
43 |
catgatgatcgagttgcgccactacactcattgaagctattggcggt |
89 |
Q |
| |
|
||||||||||| |||| |||| |||| |||||||||||||||||||| |
|
|
| T |
8559468 |
catgatgatcgtgttgtgccattacattcattgaagctattggcggt |
8559514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University