View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11567_high_14 (Length: 264)
Name: NF11567_high_14
Description: NF11567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11567_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 47 - 247
Target Start/End: Complemental strand, 34563718 - 34563518
Alignment:
| Q |
47 |
acaattcacgaacacaaatggtttttgacaacctagctccatccaaacaattactactagtttcatgctgagctcataataccaatatctgataagttac |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34563718 |
acaattcacgaacacaaatggtttttgacaacgtagctccatccaaacaattactactagtttcatgctgagctcataataccaatatctgataagttac |
34563619 |
T |
 |
| Q |
147 |
cgctaagggcatctaatcaatctttttataataatctaattataaaatcgattgcatcaaagtgataattcttttggtcaacatgtgcatcatattcatc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| ||||||| ||||||||||||| |
|
|
| T |
34563618 |
cgctaagggcatctaatcaatctttttataataatctaattataaaatcgattgcatcaaagtgatatttctttcggtgaacatgtccatcatattcatc |
34563519 |
T |
 |
| Q |
247 |
a |
247 |
Q |
| |
|
| |
|
|
| T |
34563518 |
a |
34563518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University