View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11567_high_23 (Length: 229)
Name: NF11567_high_23
Description: NF11567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11567_high_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 3489075 - 3489285
Alignment:
| Q |
1 |
caatgaaaaacctggccattgacactttagatcgaatctttttcttaaattatcaccgacccatgtagttatttccaatctttttcattttcttaaatta |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3489075 |
caatgaaaaaccttgccattgacactttagatcgaatctttttcttaaattatcaccgacccatgtagttatatccaatctttttcattttcttaaatta |
3489174 |
T |
 |
| Q |
101 |
ttagttatgtcgatgtgtcgtgttagtatggtgtctgatgtatgtagactacctgcttgatttgcttgatatggacctttttgttttacgagtgtctgtt |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3489175 |
ttagttatgttgatgtgtcgtgttagtatggtgtctgatgtatgtcgactacctgcttgatttgcttgatatggacctttttgttttacgagtgtctgtt |
3489274 |
T |
 |
| Q |
201 |
aaatcttagag |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
3489275 |
aaatcttagag |
3489285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University