View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11567_high_25 (Length: 215)
Name: NF11567_high_25
Description: NF11567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11567_high_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 41117124 - 41116927
Alignment:
| Q |
1 |
caaacttttacttttcatttctttctgattgggttgaacgtaaccaaattttgacttctatttttgattatttatagttgataacatgtttgatggggga |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41117124 |
caaactttaacttttcatttctttctgattgggttgaacgtaaccaaattttgacttctatttttgattatttatagttgataacatgtttgatgggg-a |
41117026 |
T |
 |
| Q |
101 |
catttttgcagtcaagagataccaccaacaccagggcagtcagttaaggaacccatgttcattcctattgcagtaggtctgctagattcaactgggaag |
199 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41117025 |
catttttgcagtcaagagataccaccaactccagggcagtcagttaaggaacccatgttcattcctattgcagtaggtctgctagattcaactgggaag |
41116927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 195
Target Start/End: Complemental strand, 41104923 - 41104725
Alignment:
| Q |
1 |
caaacttttacttttcatttctttctgattgggttgaacgtaaccaaattttgacttct-atttttgattatttatagtt----gataacatgtttgatg |
95 |
Q |
| |
|
||||||| |||||| |||||| |||||||||||| || || | |||||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
41104923 |
caaacttcaactttttatttctctctgattgggttaaaggtgattaaattttgacttctgatttatgattatttatttatctccgttaacatgtttgatg |
41104824 |
T |
 |
| Q |
96 |
ggggacatttttgcagtcaagagataccaccaacaccagggcagtcagttaaggaacccatgttcattcctattgcagtaggtctgctagattcaactgg |
195 |
Q |
| |
|
| | ||||||||||||||||||||| || ||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |||| ||||||||||| |
|
|
| T |
41104823 |
gcg-acatttttgcagtcaagagatcccgccaactccagggcagtcagttaaggaacccatgtttattcctattgcagtaggtttgcttgattcaactgg |
41104725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University