View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11567_high_26 (Length: 210)
Name: NF11567_high_26
Description: NF11567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11567_high_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 16 - 196
Target Start/End: Complemental strand, 35047227 - 35047047
Alignment:
| Q |
16 |
atgaaacaataactccgagggcaactattttgtattgggtaaaggcctaatcctaaagttagaagcctagtcctgtaattaaaggactaattttggtaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35047227 |
atgaaacaataactccgagggcaactattttgtattgggtcaaggcctaatcctaaagttagaagcctagtcctgtaattaaaggactaattttggtaaa |
35047128 |
T |
|
| Q |
116 |
ttatgctgaccatcatccacttgtaatcagatgatattctatggagaaatacctattcatgatagttgcttatatgatatt |
196 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35047127 |
ttatgctaaccatcatccacttgtaatcagatgatgttctatggagaaatacctattcatgatagttgctaatatgatatt |
35047047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University