View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11567_low_11 (Length: 325)
Name: NF11567_low_11
Description: NF11567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11567_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 8e-55; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 18 - 126
Target Start/End: Complemental strand, 21359893 - 21359785
Alignment:
| Q |
18 |
ttttgatttgtgggaaaaaagcttcaatagaagacagggtgctaaaagtagcacaggatcagaaaatgggtatctttctcttcctactttttcatttaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21359893 |
ttttgatttgtgggaaaaaagcttcaatagaagacagggtgctaaaagtagcacaggatcagaaaatgggtatctttctcttcctactttttcatttaaa |
21359794 |
T |
|
| Q |
118 |
gttaggtcc |
126 |
Q |
| |
|
||||||||| |
|
|
| T |
21359793 |
gttaggtcc |
21359785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 157 - 259
Target Start/End: Complemental strand, 21359765 - 21359663
Alignment:
| Q |
157 |
cttgggtttgtttctgaaactgtttctgactagggtttgaatgaggttatttattatgctgaaatcaatgttgtttgcataattgactgtttctatagac |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21359765 |
cttgggtttgtttctgaaactgtttctgactagggtttgaatgaggttatttattatgctgaaatcaatgttgtttgcataattgactgtttctgtagac |
21359666 |
T |
|
| Q |
257 |
ttc |
259 |
Q |
| |
|
||| |
|
|
| T |
21359665 |
ttc |
21359663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University