View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11567_low_21 (Length: 247)
Name: NF11567_low_21
Description: NF11567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11567_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 70; Significance: 1e-31; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 85 - 212
Target Start/End: Original strand, 23094706 - 23094845
Alignment:
| Q |
85 |
atttatttatgtggagatgatgtgtcacaagacgtcatctaatccagcaatacaattgcaattg----tacaaagcatt--------atacagtaatccg |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |||| | | | ||||||||||||| |
|
|
| T |
23094706 |
atttatttatgtggagatgatgtgtcacaagacgtcatctattccagcaatacaattgcaatggcacttacagaagagtacaccgagatacagtaatccg |
23094805 |
T |
|
| Q |
173 |
gatgccgaagcaaagctaatgaggtctctgcaacagaagg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23094806 |
gatgccgaagcaaagctaatgaggtctctgcaacagaagg |
23094845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 160 - 209
Target Start/End: Complemental strand, 1495398 - 1495349
Alignment:
| Q |
160 |
atacagtaatccggatgccgaagcaaagctaatgaggtctctgcaacaga |
209 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1495398 |
atacagtaatccggatgcctaagcaaagctaatgaggtctctgcaacaga |
1495349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 160 - 212
Target Start/End: Original strand, 11826937 - 11826989
Alignment:
| Q |
160 |
atacagtaatccggatgccgaagcaaagctaatgaggtctctgcaacagaagg |
212 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11826937 |
atacagtaatccagatgccgaatcaaagctaatgaggtctctgcaacagaagg |
11826989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 85 - 125
Target Start/End: Complemental strand, 1495462 - 1495422
Alignment:
| Q |
85 |
atttatttatgtggagatgatgtgtcacaagacgtcatcta |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1495462 |
atttatttatgtggagatgatgtgtcacaagacgtcatcta |
1495422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 160 - 212
Target Start/End: Complemental strand, 47346755 - 47346703
Alignment:
| Q |
160 |
atacagtaatccggatgccgaagcaaagctaatgaggtctctgcaacagaagg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47346755 |
atacagtaatccggatgccgaagcaaagctaatgaggtctctgcaacagaagg |
47346703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 47348221 - 47348174
Alignment:
| Q |
1 |
aaatggttggttattttttgacttttgaatgttgtgctgtggaacaaa |
48 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| | || |||||||| |
|
|
| T |
47348221 |
aaatggttggttattttttgatttttgaatgttgcgttgcggaacaaa |
47348174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University