View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11567_low_23 (Length: 242)
Name: NF11567_low_23
Description: NF11567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11567_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 20 - 234
Target Start/End: Original strand, 43156536 - 43156750
Alignment:
| Q |
20 |
ggatggtcttgtagctactctccatannnnnnnnn-attgacaaaactctccataatttgaaaaaatatttgtattttattatgttattttacaataaca |
118 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43156536 |
ggatggtcttgtagctactctccatattttttttttattgacaaaactctccataatttgaaaaaatatttgtattttattatgttattttacaataaca |
43156635 |
T |
 |
| Q |
119 |
atggatcaccaacaacaaagcgatttttccctccctcnnnnnnnnnnnnnnnngcgatttttcccaattttcaaagttctcttgtgagccgttaccaaaa |
218 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
43156636 |
atggatccccaacaacaaagcgatttttccctccctcaaaaaaaaaaaaaaaagcgatttttcccaattttcatagttctcttgtgagccgtcaccaaaa |
43156735 |
T |
 |
| Q |
219 |
ccttagttttcttctc |
234 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
43156736 |
-cttagttttcttctc |
43156750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University