View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11567_low_28 (Length: 209)
Name: NF11567_low_28
Description: NF11567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11567_low_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 43 - 191
Target Start/End: Complemental strand, 10100911 - 10100762
Alignment:
| Q |
43 |
gtgacacaacccgtaaaa-tcacatggaagtactaacattgcacatttttactacgaatcgcaccataaaaatgaaagatttttggaaagggaatgaaaa |
141 |
Q |
| |
|
|||||||| ||||||||| |||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10100911 |
gtgacacagcccgtaaaaatcacatagaagtactaacattgcacatttttactacaaatcgcaccataaaaatgagagatttttggaaagggaatgaaaa |
10100812 |
T |
|
| Q |
142 |
tgtttaccttgcccaaagaggacatggaaggttcttgttgtttgtgttct |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10100811 |
tgtttaccttgcccaaagaggacatggaaggttcttgttgtttgtgttct |
10100762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 191
Target Start/End: Original strand, 10214747 - 10214783
Alignment:
| Q |
155 |
caaagaggacatggaaggttcttgttgtttgtgttct |
191 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
10214747 |
caaagtggacatgggaggttcttgttgtttgtgttct |
10214783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University