View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11568_low_7 (Length: 218)
Name: NF11568_low_7
Description: NF11568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11568_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 21 - 201
Target Start/End: Original strand, 12422123 - 12422308
Alignment:
| Q |
21 |
gtattcctagggttaaacattttgaataagaaaatattaaatagttcaaaacaatcataaatgcaaagaagggagtggtagatcctcatattaaaatttt |
120 |
Q |
| |
|
||||| |||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12422123 |
gtattgctagggttaaacattttgcaaaagaaaatattaaatagttcaaaacaatcataaatgcaaagaagggagtggtagatcctcatattaaattttt |
12422222 |
T |
|
| Q |
121 |
cagattttattaagcttttagtttacttgtaagaaaagtaacaataaccacttac-----agttcagaagttatttctttatgtct |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |||||| |
|
|
| T |
12422223 |
tagattttattaagcttttagtttacttgtaagaaaagtaacaataaccactttcagctaagttcagaagttatttcttcatgtct |
12422308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University