View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11569_low_11 (Length: 235)

Name: NF11569_low_11
Description: NF11569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11569_low_11
NF11569_low_11
[»] chr4 (1 HSPs)
chr4 (93-235)||(5597184-5597326)


Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 5597184 - 5597326
Alignment:
93 ttatccccccgattgtagaaatgtaatttgcttgtaattaaatttttgactaaatttatgtgcaacttaatcatcatttcataaactatactaatgtaaa 192  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||    
5597184 ttatccccccgattatagaaatgtaatttgcttgtaattaaatttttgacttaatttatgtgcaatttaatcatcatttcataaactatactaatgtaaa 5597283  T
193 acgaatttcaaaaatttaagaataaatttagcgcctgattcat 235  Q
    |||||||||||||||||||||||||||||||||||||||||||    
5597284 acgaatttcaaaaatttaagaataaatttagcgcctgattcat 5597326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University