View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11569_low_11 (Length: 235)
Name: NF11569_low_11
Description: NF11569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11569_low_11 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 5597184 - 5597326
Alignment:
| Q |
93 |
ttatccccccgattgtagaaatgtaatttgcttgtaattaaatttttgactaaatttatgtgcaacttaatcatcatttcataaactatactaatgtaaa |
192 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5597184 |
ttatccccccgattatagaaatgtaatttgcttgtaattaaatttttgacttaatttatgtgcaatttaatcatcatttcataaactatactaatgtaaa |
5597283 |
T |
 |
| Q |
193 |
acgaatttcaaaaatttaagaataaatttagcgcctgattcat |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5597284 |
acgaatttcaaaaatttaagaataaatttagcgcctgattcat |
5597326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University