View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1156_high_11 (Length: 251)
Name: NF1156_high_11
Description: NF1156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1156_high_11 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 6 - 251
Target Start/End: Complemental strand, 43855199 - 43854954
Alignment:
| Q |
6 |
agcaccacagaatgggaaggttatgcccacaaacattgtgaatgctgaatcaaaaacattgtgaatacaaataacaattttgaatttcattnnnnnnnnn |
105 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43855199 |
agcaccaaagaatgggaaggttatgcccacaaacattgtgaatgctgaatcaaaaacattgtgaatacaaatagcaattttgaatttcattaaaaaaaaa |
43855100 |
T |
 |
| Q |
106 |
caagtagaagaaaaagacctcgaaatcatattaatggagtcatgcagtcatgaaatctccatcaaattgattgtaaaatacaattcataatatgagtcaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43855099 |
caagtagaagaaaaagacctcgaaatcatattaatggagtcaagcagtcatgaaatctccatcaaattgattgtaaaatacaattcataatatgagtcaa |
43855000 |
T |
 |
| Q |
206 |
ctattcatcatagaaaagatttgcgatttcacaaagataaaatatc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43854999 |
ctattcatcatagaaaagatttgcgatttcacaaagataaaatatc |
43854954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University