View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1156_high_12 (Length: 235)
Name: NF1156_high_12
Description: NF1156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1156_high_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 43854310 - 43854466
Alignment:
| Q |
1 |
gaaatttgtcctatgtagttactcaacaattgcatgggtggcttcattgaaaaagggagttcaaccagatgtggcatatggctacaaagccacaactcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43854310 |
gaaatttgtcctatgtagttactcaacaattgcatgggtggcttcattaaaaaagggagttcaaccagatgtggcatatggctacaaagccacaactcca |
43854409 |
T |
|
| Q |
101 |
acaggaactgttttcaatttcttcagtgctttaggtgatgttgcatttgcctatgct |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43854410 |
acaggaactgttttcaatttcttcagtgctttaggtgatgttgcatttgcctatgct |
43854466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University