View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1156_high_6 (Length: 305)
Name: NF1156_high_6
Description: NF1156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1156_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 84 - 272
Target Start/End: Complemental strand, 47518332 - 47518143
Alignment:
| Q |
84 |
attgagttaggcttaagcttaaata-taagaaatacatttgtacttgattccctctatgtatattgttttgtaaaacattatgcgtaaaggttgtataat |
182 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
47518332 |
attgagttaggcttaagcttaaatactaagaaatacatttgtacttgattctctctatgtatattgttttgtaaaacattatgcggaaaggttgtataat |
47518233 |
T |
|
| Q |
183 |
gtttctgcattatgtgaaactctcaagtccaggttcacccgcatgatgtgcttgtcaaagtcttatgttaacatacccaaataatggtct |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47518232 |
gtttctgcattatgtgaaactctcaagtccaggttcacccgcatgatgtgcttgtcaaagtcttatgttaacatacccaaataatggtct |
47518143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University