View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1156_high_8 (Length: 279)
Name: NF1156_high_8
Description: NF1156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1156_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 48 - 273
Target Start/End: Complemental strand, 8843589 - 8843363
Alignment:
| Q |
48 |
aacccataaggccaccagagtctgggttcaattctcattatcagcgtgaaaattttgttcgtggataatatgtaagtacttttgtcagtgccctctgagt |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8843589 |
aacccataaggccaccagagtctgggttcaattctcattattagcgtgaaaattttattcgtggataatatgtaagtacttttgtcagtgccctctgagt |
8843490 |
T |
|
| Q |
148 |
tttgaagtttaccctgaccctagtgagctcccgaactccaaccgacctaaacttgtttt--gacctactttgaaactgaaatggtttgagcttttgacca |
245 |
Q |
| |
|
|||||||||| ||||||| |||||||||| | || |||||||||| ||||| ||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8843489 |
tttgaagtttgccctgactctagtgagctactgagctccaaccgagctaaatttgttttaggacctactttgaaactgaaat-gtttgagcttttgacca |
8843391 |
T |
|
| Q |
246 |
tttcttgtgtttgttttaggtatggtta |
273 |
Q |
| |
|
||| |||||||||||||||||||||||| |
|
|
| T |
8843390 |
tttattgtgtttgttttaggtatggtta |
8843363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University