View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1156_low_19 (Length: 235)

Name: NF1156_low_19
Description: NF1156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1156_low_19
NF1156_low_19
[»] chr2 (1 HSPs)
chr2 (1-157)||(43854310-43854466)


Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 43854310 - 43854466
Alignment:
1 gaaatttgtcctatgtagttactcaacaattgcatgggtggcttcattgaaaaagggagttcaaccagatgtggcatatggctacaaagccacaactcca 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
43854310 gaaatttgtcctatgtagttactcaacaattgcatgggtggcttcattaaaaaagggagttcaaccagatgtggcatatggctacaaagccacaactcca 43854409  T
101 acaggaactgttttcaatttcttcagtgctttaggtgatgttgcatttgcctatgct 157  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43854410 acaggaactgttttcaatttcttcagtgctttaggtgatgttgcatttgcctatgct 43854466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University