View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11571_high_51 (Length: 276)
Name: NF11571_high_51
Description: NF11571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11571_high_51 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 3 - 189
Target Start/End: Original strand, 48362461 - 48362649
Alignment:
| Q |
3 |
actaagtcggctaattagatgaaattttaacaatgattaatggattttcagaccctacattgttctggttgtggtttttcagaccccacttattatcttt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48362461 |
actaagtcggctaattagatgaaattttaacaatgattaatggattttcagaccctacattgctctggttgtggtttttcagaccccacttattatcttt |
48362560 |
T |
 |
| Q |
103 |
tgatttagatttggatttggcttcttaatagtagaagaatatcaattacttctcccggcttataata--ttttcacatttacaaaataa |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
48362561 |
tgatttagatttggatttggcttcttaatagtagaagaatatcaattacttctcccggcttataatattttttcacatttacaaaataa |
48362649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University