View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11571_high_52 (Length: 273)
Name: NF11571_high_52
Description: NF11571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11571_high_52 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 268
Target Start/End: Original strand, 46749030 - 46749297
Alignment:
| Q |
1 |
cagacacatagtttttaattcatttcacactacttgttttcatattattatttctttcattgtaggcagagaagcaactgaactccaattggattctcat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46749030 |
cagacacatagtttttaattcatttcacactacttgttttcatattattatttctttcattttaggcagagaagcaactgaactccaattggattctcat |
46749129 |
T |
 |
| Q |
101 |
gcgtgctggaaatccaggagtccctactaccagtgagtggctcaatgaggttttggcgccaggtgctagagttggcattgatcctgttagtaacttaact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46749130 |
gcgtgctggaaatccaggagtccctactaccagtgagtggctcaatgaggttttggcgccaggtgctagagttggcattgatcctgttagtaacttaact |
46749229 |
T |
 |
| Q |
201 |
cttattttctaccttcattttaccatttagcctctcctttcaattcacttatttgaccctatgctact |
268 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
46749230 |
cttattttctaccttcattttaccatctagcctctcctttcaattcacttatttgaccttatggtact |
46749297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University