View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11571_high_64 (Length: 241)
Name: NF11571_high_64
Description: NF11571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11571_high_64 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 15 - 225
Target Start/End: Original strand, 64078 - 64294
Alignment:
| Q |
15 |
agagaaacagctcatttcattggtataatgtcaacttcttagtagtgaccaaacgttgatta------acatacatatagaaaaacaacaatggggacaa |
108 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
64078 |
agagaaacagctcatttcattggtacaatgtcaacttcttagtagtgaccaaacgttgattaacattaacatacatatagaaaaacaaaaatggggacaa |
64177 |
T |
|
| Q |
109 |
aatttcaatttccgttttaatgaatgaaaaattcactatgattgtgtttctttaacttattattagttaatggaatcatcattcactaattggcattgta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
64178 |
aatttcaatttccgttttaatgaatgaaaaattcactatgattgtgtttctttaacttattattagttaatggaatcatcattcactaattggcattgta |
64277 |
T |
|
| Q |
209 |
taaattacaaggatttg |
225 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
64278 |
taaattacaaggatttg |
64294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University