View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11571_high_70 (Length: 237)
Name: NF11571_high_70
Description: NF11571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11571_high_70 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 23 - 237
Target Start/End: Complemental strand, 34015926 - 34015713
Alignment:
| Q |
23 |
gttcgattatttaggcccaataccccacaaacattctaaatgtacccctgaggtttcttatgtaggtgaacacgattacttagcaagattcgatgaaggc |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
34015926 |
gttcgattatttaggcccaataccccacaaacattctaaatgtacccctaaggtttcttttgtaggtgaagatgattacttagcaagattcgatgaaggc |
34015827 |
T |
 |
| Q |
123 |
acaaatgaatctcgcaatgagaaaggagtgatttcaaatgtgaaaatgacgaagggataaaaaatggctagtacaaaactggaaaaaagccaagaacact |
222 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||| | ||||| |||| |||| ||||| ||||| |
|
|
| T |
34015826 |
acaaatgaaactcgcaatgagaaaggagtgatttcaaatttgaaaatgacgaagggatcgaaaatggctaatgcaaaattggagaaaatccaag-acact |
34015728 |
T |
 |
| Q |
223 |
acctacttatgatct |
237 |
Q |
| |
|
|| ||| |||||||| |
|
|
| T |
34015727 |
acatacatatgatct |
34015713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University