View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11571_low_29 (Length: 406)
Name: NF11571_low_29
Description: NF11571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11571_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 221 - 392
Target Start/End: Original strand, 8826159 - 8826330
Alignment:
| Q |
221 |
atctttctgagcttttctagtgccttttgatataacttgatggtaagctttatcatcaacttcaaattgtggtatattttgacattcaaatcttcttgta |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8826159 |
atctttctgagcttttctagtgccttttgatataacttgatggtaagctttatcatcaacttcaaattgtggtatattttgatattcaaatcttcttgta |
8826258 |
T |
 |
| Q |
321 |
atattttcagtggggcatgtgcatatttacctttgcttgtgttgtttacgtgtacctcaaggcacctaaccc |
392 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||| | || ||||||||||||||||||||||||| |
|
|
| T |
8826259 |
acattttcagtggggcatgtgcatatttacctttgcttgtgctattaacgtgtacctcaaggcacctaaccc |
8826330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University