View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11571_low_31 (Length: 373)
Name: NF11571_low_31
Description: NF11571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11571_low_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 18 - 110
Target Start/End: Complemental strand, 24914802 - 24914712
Alignment:
| Q |
18 |
actctatatactgataataagtctgaaacaaaattgtgacttatgcttgaatatgcaaatattatatcacatatagtgtatttatcgaatgtt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24914802 |
actctatatactgataataagtctgaaacaaaattgtgacttatgcttgaatatgcaaatattatatcac--atagtgtatttatcgaatgtt |
24914712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 258 - 362
Target Start/End: Complemental strand, 24914717 - 24914613
Alignment:
| Q |
258 |
aatgttctttgtttatatttatatacttattcagtagtgggcttagatgttttggaannnnnnncaggaaaaaattgttgatcttgcaatcaagtcgtct |
357 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
24914717 |
aatgttttttgtttatatttatatacttgttcagtagtgggcttagatgttttggattttttttcaggaaaaaattgttgatcttgcaatcaagtcgtct |
24914618 |
T |
 |
| Q |
358 |
aactc |
362 |
Q |
| |
|
||||| |
|
|
| T |
24914617 |
aactc |
24914613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University