View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11571_low_34 (Length: 357)
Name: NF11571_low_34
Description: NF11571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11571_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 61; Significance: 4e-26; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 259 - 346
Target Start/End: Complemental strand, 18027113 - 18027025
Alignment:
| Q |
259 |
agttaaatcatgttttaaggtcaactttgtaactcacctaattaacgtacgaa-taatcgcatattcgtaatgtgatactcatattctt |
346 |
Q |
| |
|
|||||||| || ||| |||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
18027113 |
agttaaataatttttcaaggtcaactttgtaactcacctaattaacgtaccaattaatcgcatattcgtaatgtgatacccatattctt |
18027025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University