View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11571_low_38 (Length: 338)
Name: NF11571_low_38
Description: NF11571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11571_low_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 4 - 326
Target Start/End: Original strand, 32795923 - 32796241
Alignment:
| Q |
4 |
aaaggttgcttgttcgaaaccaaccgttgccgattaatgttttgaaatataatgcattttgcaaataaaaattaaaacataatttgtggttgaacaaaat |
103 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
32795923 |
aaaggttgcttgttcgaaaccaaccggtgtcgattaatgttttgaaatataatgcattttgcaaataaaaatttaaacataatttgtggctgaacaaaat |
32796022 |
T |
 |
| Q |
104 |
cgaccccatgaccgaacaactatcaaaccactagaccaaacaagtcctttcaacatcatagggttcttcacatattttgaaaattcttcacattatgtgg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32796023 |
cgaccccatgaccgaacaactatcaaaccactagaccaaacaagtcctttcaacatcacaaggttcttcacatattttgaaaattcttcacattatgtgg |
32796122 |
T |
 |
| Q |
204 |
ggtttgggcccctattggatggagaatgaaactactcttcatatacttagagattctttctttatgcaacttatgtattaataaaatttgcaccttttga |
303 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32796123 |
ggtttgggcccctataggatggagaatgaaactactcttcatgtacttagaga----ttctttatgcaacttatgtattaataaaatttacaccttttga |
32796218 |
T |
 |
| Q |
304 |
tccgacaactaacttctctgctt |
326 |
Q |
| |
|
|| |||||||||||||||||||| |
|
|
| T |
32796219 |
tcggacaactaacttctctgctt |
32796241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University