View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11571_low_42 (Length: 322)

Name: NF11571_low_42
Description: NF11571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11571_low_42
NF11571_low_42
[»] chr5 (1 HSPs)
chr5 (18-97)||(40812577-40812656)
[»] chr8 (1 HSPs)
chr8 (70-108)||(20471112-20471150)


Alignment Details
Target: chr5 (Bit Score: 80; Significance: 2e-37; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 18 - 97
Target Start/End: Complemental strand, 40812656 - 40812577
Alignment:
18 acacactgtgcctttgtatgtcatgaatctgttatgtgcctttgtacctactcaaattgggatgataattgattccttct 97  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40812656 acacactgtgcctttgtatgtcatgaatctgttatgtgcctttgtacctactcaaattgggatgataattgattccttct 40812577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 70 - 108
Target Start/End: Complemental strand, 20471150 - 20471112
Alignment:
70 caaattgggatgataattgattccttctagcgaatgatt 108  Q
    |||||||||||| ||||||||||||||||| ||||||||    
20471150 caaattgggatgttaattgattccttctagtgaatgatt 20471112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University