View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11571_low_42 (Length: 322)
Name: NF11571_low_42
Description: NF11571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11571_low_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 80; Significance: 2e-37; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 18 - 97
Target Start/End: Complemental strand, 40812656 - 40812577
Alignment:
| Q |
18 |
acacactgtgcctttgtatgtcatgaatctgttatgtgcctttgtacctactcaaattgggatgataattgattccttct |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40812656 |
acacactgtgcctttgtatgtcatgaatctgttatgtgcctttgtacctactcaaattgggatgataattgattccttct |
40812577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 70 - 108
Target Start/End: Complemental strand, 20471150 - 20471112
Alignment:
| Q |
70 |
caaattgggatgataattgattccttctagcgaatgatt |
108 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
20471150 |
caaattgggatgttaattgattccttctagtgaatgatt |
20471112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University