View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11571_low_47 (Length: 299)

Name: NF11571_low_47
Description: NF11571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11571_low_47
NF11571_low_47
[»] chr1 (2 HSPs)
chr1 (19-271)||(32795637-32795889)
chr1 (19-80)||(26900253-26900314)


Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 19 - 271
Target Start/End: Original strand, 32795637 - 32795889
Alignment:
19 attggaatccttagcatgaattacacaatcatatcaaatgtattgatcaatgatagtttataaaaaagtttacctatttactgtgcgctagagaaaataa 118  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| ||||||| ||| |||||||||||||    
32795637 attggaatccttagcatgaattacacaattatatcaaatgtattgatcaatgatagtttataaaaaagttcaccaatttactatgcactagagaaaataa 32795736  T
119 aaaatgacttagaaataattttgatataattttgccacatgaaaatcataaattctttctctattactgcttgtagactcaatttatagagaaactcatg 218  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32795737 aaaatgacttagaaataattttgatagaattttgccacatgaaaatcataaattctttctctattactgcttgtagactcaatttatagagaaactcatg 32795836  T
219 ccattcagcaaagggaaaagcatactgaaatagtttctagatccgaacactac 271  Q
    ||| ||||||||||||||| ||||| |||||||||||||||||||||||||||    
32795837 ccactcagcaaagggaaaaacatacggaaatagtttctagatccgaacactac 32795889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 26900314 - 26900253
Alignment:
19 attggaatccttagcatgaattacacaatcatatcaaatgtattgatcaatgatagtttata 80  Q
    |||||||||||||| |||||||||||||| ||||||||  |||  |||||||||| ||||||    
26900314 attggaatccttagtatgaattacacaattatatcaaacatatcaatcaatgatattttata 26900253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University