View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11571_low_49 (Length: 292)
Name: NF11571_low_49
Description: NF11571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11571_low_49 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 13 - 276
Target Start/End: Complemental strand, 28648072 - 28647809
Alignment:
| Q |
13 |
agagtctttgcgatcacgaaacaactgttaccttatggtgatatgaggaaaatgaggcgtttatgttacacttgtactgtattggagtcggtttcgaccg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
28648072 |
agagtctttgcgatcacgaaacaactgttaccttatggtgatatgaggaaaatgaggcgtttatgttacacttgtactgtattggagtcggtttcgactg |
28647973 |
T |
 |
| Q |
113 |
tctcttcccctagcaccattctgctattgatgcacaccatttatagtattcaaactgctatgtccatttgctttcaccaccttggtcaatctccaaactt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28647972 |
tctcttcccctagcaccattctgctattgatgcacaccatttatagtattcaaactgctatgtccatttgctttcaccaccttggtcaatctccaaactt |
28647873 |
T |
 |
| Q |
213 |
caagaagaggggtagctctctccgaaatttggttacttgtttcatcaacatgtttccataatct |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
28647872 |
caagaagaggggtagctctctccgaaatttggttatttgtttcatcaacatgtttccacaatct |
28647809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University