View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11571_low_56 (Length: 263)
Name: NF11571_low_56
Description: NF11571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11571_low_56 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 18 - 233
Target Start/End: Complemental strand, 34018283 - 34018061
Alignment:
| Q |
18 |
atagcattgtttgatgaacaacaaagttgcatgacgttagggtttccttcttcaacacttgaaatttcatcgtcatgactat------cttcgcgtttgt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| || |||| ||||||| |
|
|
| T |
34018283 |
atagcattgtttgatgaacaacaaagttgcatgacgttagggtttccttcttcaacacttgaaagttcatcgtcatgatcatgaatgtcttcacgtttgt |
34018184 |
T |
 |
| Q |
112 |
ttgccattgatgataatttctcaagtgagtagcagttccgagaagttggcgaaatataatattgggaagttatcaaatgtagcgtggtagattttggc-t |
210 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| | |
|
|
| T |
34018183 |
tggccattgatgataatttctcaagtgagtagcagttccgagaagttggcgagttataatattgggaagttatgaaatgtagcgtggtagattttggctt |
34018084 |
T |
 |
| Q |
211 |
aggaccagtttttaaataactac |
233 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
34018083 |
aggaccagtttttaaataactac |
34018061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University