View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11571_low_57 (Length: 259)
Name: NF11571_low_57
Description: NF11571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11571_low_57 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 19 - 247
Target Start/End: Complemental strand, 38633032 - 38632804
Alignment:
| Q |
19 |
tactttactttgtaagcaccaggttgccccattttatcacttttattggtttcttcagcttctcccttatttatttcaacattgttctttttccatttcc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38633032 |
tactttactttgtaagcaccaggttgccccattttatcacttttattggtttcttcagcttctcccttatttatttcaacattgttctttttccatttcc |
38632933 |
T |
|
| Q |
119 |
ttgaatcttacatcataagtctatggaagataccttagggtttttctcatgttcatgattatgacagccaatatttcaacaaactaaagaggagaacaga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38632932 |
ttgaatcttacatcataagtctatggaagataccttagggtttttctcatgttcatgattatgacagccaatatttcaacaaactaaagaggagaacaga |
38632833 |
T |
|
| Q |
219 |
atgactaaaaaacctgtggtacttgttct |
247 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38632832 |
atgactaaaaaacctgtggtacttgttct |
38632804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University