View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11571_low_61 (Length: 251)

Name: NF11571_low_61
Description: NF11571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11571_low_61
NF11571_low_61
[»] chr8 (1 HSPs)
chr8 (21-199)||(10630042-10630229)


Alignment Details
Target: chr8 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 21 - 199
Target Start/End: Complemental strand, 10630229 - 10630042
Alignment:
21 agagaggaaagagtattctatattgagtatcaatcaaatgcatttcact-------tcactacttcattcactatttatacatcatacgatatagttgta 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||       ||||    ||||||||||||||||||||||| ||||||||||||    
10630229 agagaggaaagagtattctatattgagtatcaatcaaatgcatttcactacttcattcacattctcattcactatttatacatcatatgatatagttgta 10630130  T
114 tctctcaacaaaatgctaaataactaac--tnnnnnnnngttatagaatatactttgacttgtatcccaagtaatttcttattatttt 199  Q
    ||||||||||||||| ||||||||||||  |        |||||||||||||||||||||||||||||||||||||||||||||||||    
10630129 tctctcaacaaaatggtaaataactaactgtaaaaaaaagttatagaatatactttgacttgtatcccaagtaatttcttattatttt 10630042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University