View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11571_low_61 (Length: 251)
Name: NF11571_low_61
Description: NF11571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11571_low_61 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 21 - 199
Target Start/End: Complemental strand, 10630229 - 10630042
Alignment:
| Q |
21 |
agagaggaaagagtattctatattgagtatcaatcaaatgcatttcact-------tcactacttcattcactatttatacatcatacgatatagttgta |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10630229 |
agagaggaaagagtattctatattgagtatcaatcaaatgcatttcactacttcattcacattctcattcactatttatacatcatatgatatagttgta |
10630130 |
T |
|
| Q |
114 |
tctctcaacaaaatgctaaataactaac--tnnnnnnnngttatagaatatactttgacttgtatcccaagtaatttcttattatttt |
199 |
Q |
| |
|
||||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10630129 |
tctctcaacaaaatggtaaataactaactgtaaaaaaaagttatagaatatactttgacttgtatcccaagtaatttcttattatttt |
10630042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University