View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11571_low_69 (Length: 240)
Name: NF11571_low_69
Description: NF11571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11571_low_69 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 2 - 216
Target Start/End: Complemental strand, 40481786 - 40481570
Alignment:
| Q |
2 |
ttataaattcttatttttt-gttgtacatctaacacaacgatattattagattgagagtccgtttgttataatcatttttataagtattttatccattta |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40481786 |
ttataaattcttatttttttgttgtacatctaacacaacgatattattagattgagaatccgtttgttataatcatttttataagtattgtatccattta |
40481687 |
T |
|
| Q |
101 |
ttacttctactaatcgagagtcaaattttggttcaccaatatagtctccattgataaa-ttaannnnnnnnnnnngttgttgagggattgataaatttaa |
199 |
Q |
| |
|
||| |||||||||| ||| |||||||||||||||||||||||||||||||||||||| |||| || ||||||||||||||||||||| |
|
|
| T |
40481686 |
ttatttctactaattcagattcaaattttggttcaccaatatagtctccattgataaatttaactttttttttttttttttgagggattgataaatttaa |
40481587 |
T |
|
| Q |
200 |
ctcttattaatcgcaag |
216 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
40481586 |
ctcttattaatcgcaag |
40481570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University