View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11571_low_72 (Length: 237)

Name: NF11571_low_72
Description: NF11571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11571_low_72
NF11571_low_72
[»] chr5 (1 HSPs)
chr5 (23-237)||(34015713-34015926)


Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 23 - 237
Target Start/End: Complemental strand, 34015926 - 34015713
Alignment:
23 gttcgattatttaggcccaataccccacaaacattctaaatgtacccctgaggtttcttatgtaggtgaacacgattacttagcaagattcgatgaaggc 122  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| | |||||||||||||||||||||||||||    
34015926 gttcgattatttaggcccaataccccacaaacattctaaatgtacccctaaggtttcttttgtaggtgaagatgattacttagcaagattcgatgaaggc 34015827  T
123 acaaatgaatctcgcaatgagaaaggagtgatttcaaatgtgaaaatgacgaagggataaaaaatggctagtacaaaactggaaaaaagccaagaacact 222  Q
    ||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||  |||||||||| | ||||| |||| |||| ||||| |||||    
34015826 acaaatgaaactcgcaatgagaaaggagtgatttcaaatttgaaaatgacgaagggatcgaaaatggctaatgcaaaattggagaaaatccaag-acact 34015728  T
223 acctacttatgatct 237  Q
    || ||| ||||||||    
34015727 acatacatatgatct 34015713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University