View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11572_low_10 (Length: 229)
Name: NF11572_low_10
Description: NF11572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11572_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 12 - 210
Target Start/End: Complemental strand, 53309317 - 53309119
Alignment:
| Q |
12 |
gagatgaacaagatcgatgcttacttccaggtaagatcaccagcaagaagaagatcattctccatgtcttcataggcaataacatgaccaggaatggcat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53309317 |
gagatgaacaagatcgatgcttacttccaggtaagatcaccagcaagaagaagatcattctccatgtcttcataggcaataacatgaccaggaatggcat |
53309218 |
T |
|
| Q |
112 |
tagaaagatcaagatgatgatcaccggcgtcgaagtcatccgtgcaatcgacaaacatctggcggagagccttggccagactttggtagctaccgtggt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53309217 |
tagaaagatcaagatgatgatcaccggcgtcgcagtcatccgtgcaatcgacaaacatctggcggagagccttggccagactttggtagctaccgtggt |
53309119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University