View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11573_high_31 (Length: 229)
Name: NF11573_high_31
Description: NF11573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11573_high_31 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 7 - 229
Target Start/End: Complemental strand, 52731695 - 52731471
Alignment:
| Q |
7 |
gcttggccctcttgttctaatatcatcattaatggcgtgtcaaaccctgttatgatctctttgaattactttctttatgactcgctctctttgatattaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
52731695 |
gcttggccctcttgttctaatatcatcattaatggcgtgtcaaaccctgttatgatctctttgaattactttctttatgactcgctctat--gatattaa |
52731598 |
T |
|
| Q |
107 |
ttaatttaaatttat----caaaggtttttaagtgcggtggaggttgtcttgtcagcaaaggagggtgtggaatgaatatcaaagaagaatgtggaagac |
202 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52731597 |
ttaatttaaatttatatatcaaaggtttttaagtgcggtggaggttgtcttgtcagcaaaggagggtgtggaatgaatatcaaagaagaatgtggaagac |
52731498 |
T |
|
| Q |
203 |
aaagcagaaacatttgaatgctaccaa |
229 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
52731497 |
aaagcagaaacatttgaatgctaccaa |
52731471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University