View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11573_low_24 (Length: 249)
Name: NF11573_low_24
Description: NF11573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11573_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 54 - 234
Target Start/End: Complemental strand, 32562806 - 32562626
Alignment:
| Q |
54 |
atatataatctatgttttgtgtagaatcgagttatagtatgttttgattgaatgacactgacatcggaaatcaaacatggcattgacatactgacatgta |
153 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32562806 |
atatataatctatgttttgtgtagaatggagttatagtatgttttgattgaatgacactgacatcggaaatcaaacatggcattgacatactgacatgta |
32562707 |
T |
 |
| Q |
154 |
ggcacatatatgatttaagaaaatgattttgattgaatgtaatgatgtatgtttgtgctagacattggtacgtgttgaata |
234 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32562706 |
ggcacatatatgatttaagaaaatgattgtgattgaatgtaatgatgtatgtttgtgctagacattggtacgtgttgaata |
32562626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University