View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11574_high_15 (Length: 378)
Name: NF11574_high_15
Description: NF11574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11574_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 2e-59; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 239 - 355
Target Start/End: Original strand, 20135209 - 20135325
Alignment:
| Q |
239 |
cctacattgtaatggcggagaggatatatggcaagtatttaatgacgcggtgcattttttcgggatgttgtttgataatattcacaaatggtcggaacaa |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20135209 |
cctacattgtaatggcggagaggatatatggcaagtatttaatgacgcggtgcattttttcgggatgttgtttgataatattcacaaatggtcggaacaa |
20135308 |
T |
 |
| Q |
339 |
gatactagatatgaacg |
355 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
20135309 |
gatactagatatgaacg |
20135325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 1 - 100
Target Start/End: Original strand, 20131526 - 20131625
Alignment:
| Q |
1 |
tttttgggactattattctgtttgataaaaacatcttcataaacaatcattttttaaaataaaatgaccacctttcaaagtttttcatttagagattttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20131526 |
tttttgggactattattctgtttgataaaaacatcttcataaaaaatcattttttaaaataaaatgaccacctttcgaagtttttcatttagagattttc |
20131625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 179 - 243
Target Start/End: Original strand, 20131689 - 20131753
Alignment:
| Q |
179 |
aatcgatgatgctggtttttctcaggttgtggttactgcaatgggaggggatagagttttcctac |
243 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
20131689 |
aatcgatgctgctggtttttctcaggttgtggttactctaatgggaggggatagagttttcctac |
20131753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 117; Significance: 2e-59; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 239 - 355
Target Start/End: Complemental strand, 44356862 - 44356746
Alignment:
| Q |
239 |
cctacattgtaatggcggagaggatatatggcaagtatttaatgacgcggtgcattttttcgggatgttgtttgataatattcacaaatggtcggaacaa |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44356862 |
cctacattgtaatggcggagaggatatatggcaagtatttaatgacgcggtgcattttttcgggatgttgtttgataatattcacaaatggtcggaacaa |
44356763 |
T |
 |
| Q |
339 |
gatactagatatgaacg |
355 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
44356762 |
gatactagatatgaacg |
44356746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 44360542 - 44360443
Alignment:
| Q |
1 |
tttttgggactattattctgtttgataaaaacatcttcataaacaatcattttttaaaataaaatgaccacctttcaaagtttttcatttagagattttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44360542 |
tttttgggactattattctgtttgataaaaacatcttcataaaaaatcattttttaaaataaaatgaccacctttcgaagtttttcatttagagattttc |
44360443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 179 - 243
Target Start/End: Complemental strand, 44360379 - 44360315
Alignment:
| Q |
179 |
aatcgatgatgctggtttttctcaggttgtggttactgcaatgggaggggatagagttttcctac |
243 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44360379 |
aatcgatgctgctggtttttctcaggttgtggttactctaatgggaggggatagagttttcctac |
44360315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University