View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11574_high_22 (Length: 252)
Name: NF11574_high_22
Description: NF11574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11574_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 239
Target Start/End: Complemental strand, 42089335 - 42089118
Alignment:
| Q |
18 |
atcactcacccacgcattatagaataatataattatttcttgttccctttcatgtatctttacattaacgaaataaccaaatcatgataatcactaaatt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42089335 |
atcactcacccacgcattatagaataatataatgatttcttgttccctttcatgtatctttacattaacgaaataaccaaatcatgataatcactaaatt |
42089236 |
T |
 |
| Q |
118 |
aaatttgaatgccctgaaaacatgaaaatgcatatagtactatttactttctgtacaatatctcatgcaatagatagtggtatgtatcatactacacaaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
42089235 |
aaatttgaatgccctgaaaacatgaaaatgcatatagtactatttactttctgtataatatctcatgca----atagtggtatgcatcatactacacaaa |
42089140 |
T |
 |
| Q |
218 |
agtactatggtcaattctggtc |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
42089139 |
agtactatggtcaattctggtc |
42089118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University