View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11574_high_26 (Length: 237)
Name: NF11574_high_26
Description: NF11574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11574_high_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 76 - 236
Target Start/End: Complemental strand, 20131436 - 20131276
Alignment:
| Q |
76 |
aagaaaaatatgaatgtannnnnnnncttgtatatttatttcattgaaatggtagtcacatagtaatattaaaggaatccatgtgagaaggttagaacgg |
175 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20131436 |
aagaaaaatatgaatgtattttttttcttgtatatttatttcattgaaatggtagtcacatagtaatattaaaggaatccatgtgagaaggttagaacgg |
20131337 |
T |
 |
| Q |
176 |
ggcaacgggcagtagaaggatgggcgtggcaaggacatcaatgcatatgcagtttcccccc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
20131336 |
ggcaacgggcagtagaaggatgggcgtggctaggacatcaatgcatatgcagtttcccccc |
20131276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 76 - 236
Target Start/End: Original strand, 44360633 - 44360793
Alignment:
| Q |
76 |
aagaaaaatatgaatgtannnnnnnncttgtatatttatttcattgaaatggtagtcacatagtaatattaaaggaatccatgtgagaaggttagaacgg |
175 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44360633 |
aagaaaaatatgaatgtattttttttcttgtatatttatttcattgaaatggtagtcacatagtaatattaaaggaatccatgtgagaaggttagaacgg |
44360732 |
T |
 |
| Q |
176 |
ggcaacgggcagtagaaggatgggcgtggcaaggacatcaatgcatatgcagtttcccccc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44360733 |
ggcaacgggcagtagaaggatgggcgtggctaggacatcaatgcatatgcagtttcccccc |
44360793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University