View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11574_high_9 (Length: 449)
Name: NF11574_high_9
Description: NF11574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11574_high_9 |
 |  |
|
| [»] scaffold0095 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0095 (Bit Score: 253; Significance: 1e-140; HSPs: 1)
Name: scaffold0095
Description:
Target: scaffold0095; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 50 - 413
Target Start/End: Complemental strand, 27188 - 26822
Alignment:
| Q |
50 |
tgttgtttgttctcgtgtcaggtttgagagcagtgagatgctggcaacgtttttgatttctacaccactgttatcggagtcatggaggatgtgcagtcag |
149 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||||||||||| | ||| ||||||||||| |||||||| |||||||||||||| |||| || || |
|
|
| T |
27188 |
tgttgttttttcacgtgtcaggtttgagagcagtgagatgctggccaggttcttgatttctacgccactgttgccggagtcatggaggttgtgtagcaag |
27089 |
T |
 |
| Q |
150 |
gccaacgcctccgctgtcaacctccgcagttttgtggtggagcgtgttggcaacgtcgtgtatgtagctttctccggcgttcaaatggccggcgggggat |
249 |
Q |
| |
|
| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27088 |
gtcaacgcctccgctgtcaacttccgcagttttgtggtggagcgtgttggcaacgtcgtgtatgtagctttctccggctttcaaatggccggcgggggat |
26989 |
T |
 |
| Q |
250 |
ccgatccgagttggagaacgttggagccgttgaaaagcatcggtggagtgccactgttttcgaggcatcggaata---aagaggaggagccggtgaaggt |
346 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||| || ||||||||||| ||||||||| || |||||||| |||||||||||||||||||||| |
|
|
| T |
26988 |
ccgatccgagttggagaacgttggagcctttggaaagtattggtggagtgccgttgttttcgacgcgtcggaataaggaagaggaggagccggtgaaggt |
26889 |
T |
 |
| Q |
347 |
tcattccgggatcttgaatctcttttcttcccttttcaactcaatccaaaaccaggtttgtttattt |
413 |
Q |
| |
|
||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26888 |
tcactccgggatgttgaatctcttttcttcccttttcaactcaatccaaaaccaggtttgtttattt |
26822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 253; Significance: 1e-140; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 50 - 413
Target Start/End: Complemental strand, 39403230 - 39402864
Alignment:
| Q |
50 |
tgttgtttgttctcgtgtcaggtttgagagcagtgagatgctggcaacgtttttgatttctacaccactgttatcggagtcatggaggatgtgcagtcag |
149 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||||||||||| | ||| ||||||||||| |||||||| |||||||||||||| |||| || || |
|
|
| T |
39403230 |
tgttgttttttcacgtgtcaggtttgagagcagtgagatgctggccaggttcttgatttctacgccactgttgccggagtcatggaggttgtgtagcaag |
39403131 |
T |
 |
| Q |
150 |
gccaacgcctccgctgtcaacctccgcagttttgtggtggagcgtgttggcaacgtcgtgtatgtagctttctccggcgttcaaatggccggcgggggat |
249 |
Q |
| |
|
| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39403130 |
gtcaacgcctccgctgtcaacttccgcagttttgtggtggagcgtgttggcaacgtcgtgtatgtagctttctccggctttcaaatggccggcgggggat |
39403031 |
T |
 |
| Q |
250 |
ccgatccgagttggagaacgttggagccgttgaaaagcatcggtggagtgccactgttttcgaggcatcggaata---aagaggaggagccggtgaaggt |
346 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||| || ||||||||||| ||||||||| || |||||||| |||||||||||||||||||||| |
|
|
| T |
39403030 |
ccgatccgagttggagaacgttggagcctttggaaagtattggtggagtgccgttgttttcgacgcgtcggaataaggaagaggaggagccggtgaaggt |
39402931 |
T |
 |
| Q |
347 |
tcattccgggatcttgaatctcttttcttcccttttcaactcaatccaaaaccaggtttgtttattt |
413 |
Q |
| |
|
||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39402930 |
tcactccgggatgttgaatctcttttcttcccttttcaactcaatccaaaaccaggtttgtttattt |
39402864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University