View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11574_low_23 (Length: 254)
Name: NF11574_low_23
Description: NF11574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11574_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 17 - 168
Target Start/End: Complemental strand, 42853902 - 42853759
Alignment:
| Q |
17 |
agtttcatatttatacttcaatagtgtaaaaaatggagaaatgatatatgtacaacactaaaaccattttgtgacaacttttgggacaactctctaactc |
116 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
42853902 |
agtttcatatttattcttcaatagtgtaaaaaatggagaaatgatatatgtacaacactacaaccattttgtgacaacttttgggaca--------actc |
42853811 |
T |
 |
| Q |
117 |
cctctttctctcctactctctttgtatatctttgattgtcccataatttgtc |
168 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42853810 |
cctctttctctcatactctctttgtatatctttgattgtcccataatttgtc |
42853759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 75 - 111
Target Start/End: Complemental strand, 42225822 - 42225786
Alignment:
| Q |
75 |
taaaaccattttgtgacaacttttgggacaactctct |
111 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42225822 |
taaaaccattttgtaacaacttttgggacaactctct |
42225786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 78 - 107
Target Start/End: Complemental strand, 37672315 - 37672286
Alignment:
| Q |
78 |
aaccattttgtgacaacttttgggacaact |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37672315 |
aaccattttgtgacaacttttgggacaact |
37672286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 78 - 106
Target Start/End: Original strand, 28508497 - 28508525
Alignment:
| Q |
78 |
aaccattttgtgacaacttttgggacaac |
106 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
28508497 |
aaccattttgtgacaacttttgggacaac |
28508525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University