View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11574_low_26 (Length: 248)
Name: NF11574_low_26
Description: NF11574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11574_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 77 - 227
Target Start/End: Complemental strand, 38931593 - 38931443
Alignment:
| Q |
77 |
acaaaaactaaagagcattgtcaccatggtgaaaaagaaagaagccatggtgagagaacaagaaccagagaacatgaagaacaacacaacttcttcgatg |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38931593 |
acaaaaactaaagagcattgtcaccatggtgaaaaagaaagaagccatggtgagagaacaagaaccagagaacatgaaggacaacacaacttcttcgatg |
38931494 |
T |
 |
| Q |
177 |
aaaccgtttgcacattgaagcttcatgagaacatagctgatccttcacgtg |
227 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38931493 |
aaactgtttgcacattgaagcttcatgagaacatagctgatccttcacgtg |
38931443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University