View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11574_low_27 (Length: 238)
Name: NF11574_low_27
Description: NF11574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11574_low_27 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 16 - 238
Target Start/End: Complemental strand, 46463395 - 46463174
Alignment:
| Q |
16 |
catgattacggctcaccgtgattttgacaaatccaccgtgataccaaacataatttgtagcaccgacacttctggtgtccaacatgtgttggtgtttgac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
46463395 |
catgattacggctcaccgtgattttgacaa-tccaccgtgataccaaacataatttgtagcaccgacacttctagtgtccaacatgtgttggtgtttgac |
46463297 |
T |
|
| Q |
116 |
accgacataacactgatacacgtgattgcattcannnnnnnnaaattattattggtatcgacgtgtcagtgtcaatgattcatagcaaacataatgattc |
215 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46463296 |
accgacataacaccgatacacgtgattgcattcatttttttaaaattattattggtatcgacgtgtcagtgtcaatgattcatagcaaacataatgattc |
46463197 |
T |
|
| Q |
216 |
attacaaacatgtacttattctc |
238 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
46463196 |
attacaaacatgtacttattctc |
46463174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 158 - 187
Target Start/End: Complemental strand, 52067112 - 52067083
Alignment:
| Q |
158 |
aaattattattggtatcgacgtgtcagtgt |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
52067112 |
aaattattattggtatcgacgtgtcagtgt |
52067083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University