View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11574_low_29 (Length: 230)
Name: NF11574_low_29
Description: NF11574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11574_low_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 52476918 - 52476708
Alignment:
| Q |
1 |
aagaaacgagggagggaaattctcaaagaagtacataaagtcaatctccaagctcttgggtcccgatagcttgctatgtgcagctgagcatcatcacaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52476918 |
aagaaacgagggagggaaattctcaaagaagtacataaagtcaatctccaagctcttgggtcccgatagcttgctatgtgcagctgagcatcatcacaaa |
52476819 |
T |
|
| Q |
101 |
ctcattcgtagccgtctcttgagtttgttctcgcctcattctttgccttcctttgttcaactgtttgatgaacttgtaactgaagctacaagtacctgga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
52476818 |
ctcattcgtagccgtctcttgagtttgttctcgcctcattctttgccttcctttgttcaactgtttgatgaacttgtaactgaagctacaggtacctgga |
52476719 |
T |
|
| Q |
201 |
catgtggatcc |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
52476718 |
catgtggatcc |
52476708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University