View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11575_high_21 (Length: 417)
Name: NF11575_high_21
Description: NF11575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11575_high_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 369; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 369; E-Value: 0
Query Start/End: Original strand, 19 - 407
Target Start/End: Original strand, 30931844 - 30932232
Alignment:
| Q |
19 |
tgatgtctcccgatgaaaaactgcttgcggttatgggttttattatgttactagtgcgccccgcactctccatttatattgatgtgtttcgtagcacaca |
118 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30931844 |
tgatgtctcccgatgaaaagctgcttgcggttatgggttttattatgttactagtgtgccccgcactctccatttatattgatgtgtttcgtagcacaca |
30931943 |
T |
 |
| Q |
119 |
agtagtggttgatgcatgggaagtcttaatctttgtcgtaccttttatagcacggagtgtatggtttctggcatgttccatcttttgcaggaatggtaat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30931944 |
agtagtggttgatgcatgggaagtcttaatctttgccgtaccttttatagcatggagtgtatggtttctggcatgttccatcttttgcaggaatggtaat |
30932043 |
T |
 |
| Q |
219 |
atggaatgagagtaacttcattaggtggtccttcataggcttcaccatttctgcctacatatacggggcttccacatttctgtttactatgatgaggttt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30932044 |
atggaatgagagtaacttcattaggtggtccttcataggcttcaccatttctgcctacatatacggggcttccacatttctgtttactatgatgaggttt |
30932143 |
T |
 |
| Q |
319 |
gtaattaattacaaatcaggtgagctaaatctaatcttgggtgtctttattatttgtgctgggttgctgttactttcgacatttctctg |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30932144 |
gtaattaattacaaatcaggtgagctaaatctaatcttgggtgtctttattatttgtgctgggttgctgttacttttgacatttctctg |
30932232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University