View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11575_high_23 (Length: 394)
Name: NF11575_high_23
Description: NF11575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11575_high_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 3e-61; HSPs: 6)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 242 - 381
Target Start/End: Original strand, 4384677 - 4384816
Alignment:
| Q |
242 |
ttgtccctgctcattaactcataaaccaacattcaatccattccttcatcacactatcctatcaactttaccaagtttttgtggccggttttcccgatcc |
341 |
Q |
| |
|
||||| |||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4384677 |
ttgtcactgctcattaactcatgcaccaacattctatccattccttcatcacactatcctatcaactttaccaagtttttgtggccggttttaccgatcc |
4384776 |
T |
 |
| Q |
342 |
attctcttaacagcaatgacattacaagatgttgctacct |
381 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4384777 |
attctcttaacagcaatgacattacaagatgttgctacct |
4384816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 4384571 - 4384661
Alignment:
| Q |
1 |
ccttgtagaatagaaagagatgatgatatatttcaggtttttctttagcacaagggaaagtggatcaaatatgatagttcagttctgaata |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4384571 |
ccttgtagaatagaaagagatgatgatatatttcaggtttttctttagcacaagggaaagtggatcaaatatgatagttcagttctgaata |
4384661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 64 - 166
Target Start/End: Complemental strand, 4111291 - 4111190
Alignment:
| Q |
64 |
atcaaatatgatagttcagttctgaataattcagagactttatcagtggatgtgaaacttgtaagatattgccaatgaaaatctcatggtttttctttaa |
163 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4111291 |
atcaaatatgatagttcagttctgaa-aattctgagactttagcagtggatgtgaaacttgtaagatattgcaaatgaaaatctcatggtttttctttaa |
4111193 |
T |
 |
| Q |
164 |
ata |
166 |
Q |
| |
|
||| |
|
|
| T |
4111192 |
ata |
4111190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 320 - 377
Target Start/End: Complemental strand, 4110454 - 4110397
Alignment:
| Q |
320 |
ttgtggccggttttcccgatccattctcttaacagcaatgacattacaagatgttgct |
377 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4110454 |
ttgtggccggttttaccgatccattctcttaacagcaatgacattacaagatgttgct |
4110397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 252 - 333
Target Start/End: Complemental strand, 4107305 - 4107224
Alignment:
| Q |
252 |
tcattaactcataaaccaacattcaatccattccttcatcacactatcctatcaactttaccaagtttttgtggccggtttt |
333 |
Q |
| |
|
|||| |||||||| |||||||||| || |||||| |||||||| ||||| |||||||| |||||||||||||||| |||||| |
|
|
| T |
4107305 |
tcatgaactcatataccaacattctatgcattccctcatcacagtatccaatcaacttgaccaagtttttgtggcaggtttt |
4107224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 249 - 333
Target Start/End: Complemental strand, 4130489 - 4130405
Alignment:
| Q |
249 |
tgctcattaactcataaaccaacattcaatccattccttcatcacactatcctatcaactttaccaagtttttgtggccggtttt |
333 |
Q |
| |
|
||||||| |||||||| || ||||||| || || |||||||||||| |||| | |||| |||||||||||||||||| |||||| |
|
|
| T |
4130489 |
tgctcatgaactcatatactaacattctatgcaatccttcatcacaaaatccaaccaaccttaccaagtttttgtggcaggtttt |
4130405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000009; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 34687398 - 34687359
Alignment:
| Q |
1 |
ccttgtagaatagaaagagatgatgatatatttcaggttt |
40 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
34687398 |
ccttgtagaagagaaagagatgatgatatattttaggttt |
34687359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 34709810 - 34709771
Alignment:
| Q |
1 |
ccttgtagaatagaaagagatgatgatatatttcaggttt |
40 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
34709810 |
ccttgtagaagagaaagagatgatgatatattttaggttt |
34709771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University