View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11575_high_39 (Length: 273)

Name: NF11575_high_39
Description: NF11575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11575_high_39
NF11575_high_39
[»] chr6 (2 HSPs)
chr6 (219-270)||(22583421-22583472)
chr6 (219-270)||(22588252-22588303)


Alignment Details
Target: chr6 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 219 - 270
Target Start/End: Complemental strand, 22583472 - 22583421
Alignment:
219 aggtgtgggggatggggttgattgaacatgtgtgttttgctgtgtgttttgc 270  Q
    |||||||||||||| ||||||||||||||||||||||||||||||| |||||    
22583472 aggtgtgggggatgaggttgattgaacatgtgtgttttgctgtgtgatttgc 22583421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 219 - 270
Target Start/End: Complemental strand, 22588303 - 22588252
Alignment:
219 aggtgtgggggatggggttgattgaacatgtgtgttttgctgtgtgttttgc 270  Q
    |||||||||||||| ||||||||||||||||||||||||||||||| |||||    
22588303 aggtgtgggggatgaggttgattgaacatgtgtgttttgctgtgtgatttgc 22588252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University